lenti packaging vectors pax2 (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
lenti packaging vectors pax2
Lenti Packaging Vectors Pax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/packaging+vectors+pax2/Pax2+(Plasmid+%2335002)/pmc12423405-247-9-13
Average 94 stars, based on 96 article reviews
Lenti Packaging Vectors Pax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/packaging+vectors+pax2/Pax2+(Plasmid+%2335002)/pmc12423405-247-9-13
Average 94 stars, based on 96 article reviews
lenti packaging vectors pax2 - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Produced:Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis Article Snippet: The viral supernatant was filtered through 0.45 μm filter and added to the target cells along with 8 μg/ml polybrene (Sigma, H9268). .. Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48 h. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA-2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis. Article Snippet: Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48h. .. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Transfection:Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis Article Snippet: The viral supernatant was filtered through 0.45 μm filter and added to the target cells along with 8 μg/ml polybrene (Sigma, H9268). .. Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48 h. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA-2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Article Title: Markers of triple-negative breast cancer and uses thereof Article Snippet: After 48 hrs, apoptosis was determined by measuring luciferase from activated caspase 3/7 upon addition of Caspase-Glo reagent (Promega, Madison, WI). .. Relative levels of caspase activity were normalized to viable cell number determined by metabolic reduction of Alamar blue. shRNA Knockdown of AR 293FT cells were transfected with Lipofectamine 2000 (Invitrogen, Grand Island, NY) the Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis. Article Snippet: Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48h. .. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Expressing:Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis Article Snippet: The viral supernatant was filtered through 0.45 μm filter and added to the target cells along with 8 μg/ml polybrene (Sigma, H9268). .. Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48 h. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA-2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis. Article Snippet: Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48h. .. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Control:Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis Article Snippet: The viral supernatant was filtered through 0.45 μm filter and added to the target cells along with 8 μg/ml polybrene (Sigma, H9268). .. Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48 h. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA-2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Article Title: Markers of triple-negative breast cancer and uses thereof Article Snippet: After 48 hrs, apoptosis was determined by measuring luciferase from activated caspase 3/7 upon addition of Caspase-Glo reagent (Promega, Madison, WI). .. Relative levels of caspase activity were normalized to viable cell number determined by metabolic reduction of Alamar blue. shRNA Knockdown of AR 293FT cells were transfected with Lipofectamine 2000 (Invitrogen, Grand Island, NY) the Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis. Article Snippet: Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48h. .. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Retroviral:Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis Article Snippet: The viral supernatant was filtered through 0.45 μm filter and added to the target cells along with 8 μg/ml polybrene (Sigma, H9268). .. Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48 h. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA-2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Article Title: O-GlcNAcylation of FOXK1 co-opts BAP1 to orchestrate the E2F pathway and promotes oncogenesis. Article Snippet: Following one to three infections, 16 h each, the cells were selected with 2 μg/ml puromycin (Bioshop, PUR333) for 48h. .. Lentiviruses were produced in H293FT with PEI transfection by combining lentiviral pLenti-CMV expression vector (Addgene #17452) coding for FOXK1, FOXK2, or pLentiCRISPR_V2 vector for gRNA (Addgene #52961) targeting FOXK1 (gRNA-1: CACCGGAACATGGCCGAAGTCGGCG, gRNA2: CACCGCGGCAAGAACGGCGTCTTCG) or control gRNA targeting GFP (CACCGGGGCGAGGAGCTGTTCACCG) with Activity Assay:Article Title: Markers of triple-negative breast cancer and uses thereof Article Snippet: After 48 hrs, apoptosis was determined by measuring luciferase from activated caspase 3/7 upon addition of Caspase-Glo reagent (Promega, Madison, WI). .. Relative levels of caspase activity were normalized to viable cell number determined by metabolic reduction of Alamar blue. shRNA Knockdown of AR 293FT cells were transfected with Lipofectamine 2000 (Invitrogen, Grand Island, NY) the shRNA:Article Title: Markers of triple-negative breast cancer and uses thereof Article Snippet: After 48 hrs, apoptosis was determined by measuring luciferase from activated caspase 3/7 upon addition of Caspase-Glo reagent (Promega, Madison, WI). .. Relative levels of caspase activity were normalized to viable cell number determined by metabolic reduction of Alamar blue. shRNA Knockdown of AR 293FT cells were transfected with Lipofectamine 2000 (Invitrogen, Grand Island, NY) the Knockdown:Article Title: Markers of triple-negative breast cancer and uses thereof Article Snippet: After 48 hrs, apoptosis was determined by measuring luciferase from activated caspase 3/7 upon addition of Caspase-Glo reagent (Promega, Madison, WI). .. Relative levels of caspase activity were normalized to viable cell number determined by metabolic reduction of Alamar blue. shRNA Knockdown of AR 293FT cells were transfected with Lipofectamine 2000 (Invitrogen, Grand Island, NY) the Construct:Article Title: Markers of triple-negative breast cancer and uses thereof Article Snippet: After 48 hrs, apoptosis was determined by measuring luciferase from activated caspase 3/7 upon addition of Caspase-Glo reagent (Promega, Madison, WI). .. Relative levels of caspase activity were normalized to viable cell number determined by metabolic reduction of Alamar blue. shRNA Knockdown of AR 293FT cells were transfected with Lipofectamine 2000 (Invitrogen, Grand Island, NY) the |
